Review



dna protein-binding detection kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher dna protein-binding detection kit
    Dna Protein Binding Detection Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+protein+binding+detection+kit/pmc10080013-67-16-18
    Average 90 stars, based on 1 article reviews
    dna protein-binding detection kit - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Electrophoretic Mobility Shift Assay:

    Article Title: Effects of Genetic and Pharmacologic Inhibition of COX-2 on Colitis-associated Carcinogenesis in Mice
    Article Snippet: .. Electrophoretic mobility shift assay Electrophoretic mobility shift assay was performed using a DNA-protein binding detection kit (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol. .. Briefly, the NF-κB oligonucleotide probe (5’-AGT TGA GGG GAC TTT CCC AGG C-3’) was labeled with [g-32P] ATP by T4 polynucleotide kinase and purified on a Nick column (Amersham Pharmacia Biotech, Piscataway, NJ, USA).

    Article Title: Wip1 directly dephosphorylates NLK and increases Wnt activity during germ cell development.
    Article Snippet: .. Electrophoretic mobility shift assay (EMSA) The EMSA for DNA binding of the different transcription factors was performed by using a DNA-protein binding detection kit according to the manufacturer’s protocol (ThermoFisher). .. Briefly, CD1TOP oligonucleotide harboring the binding sites for Cyclin D1 (5’- CTCTGCCGGCCTTTGATCTTTGCTTAACAACA-3’) was labeled with [γ32 P] AC C EP TE D M AN U SC R IP T ATP by using T4 polynucleotide kinase, and these oligonucleotides were purified on a Nick column (GE Healthcare, UK).

    Article Title: Leptin induces SIRT1 expression through activation of NF-E2-related factor 2: Implications for obesity-associated colon carcinogenesis.
    Article Snippet: Leptin, a representative adipokine secreted from the white adipose tissue, is considered as a potential linker between obesity and cancer.. SIRT1 is a NAD-dependent histone/protein deacetylase speculated to function as an oncogene.. In the present study, we found that leptin signaling-defective ob/ob and db/db mice had lower colonic expression of SIRT1 compared with leptin signaling-intact C57BL/6J mice, implying that leptin signaling is crucial for SIRT1 expression in vivo.

    Article Title: Effects of Genetic and Pharmacologic Inhibition of COX-2 on Colitis-associated Carcinogenesis in Mice
    Article Snippet: .. Electrophoretic mobility shift assay was performed using a DNA-protein binding detection kit (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol. .. Briefly, the NF-κB oligonucleotide probe (5’-AGT TGA GGG GAC TTT CCC AGG C-3’) was labeled with [γ- 32 P] ATP by T4 polynucleotide kinase and purified on a Nick column (Amersham Pharmacia Biotech, Piscataway, NJ, USA).

    Binding Assay:

    Article Title: Effects of Genetic and Pharmacologic Inhibition of COX-2 on Colitis-associated Carcinogenesis in Mice
    Article Snippet: .. Electrophoretic mobility shift assay Electrophoretic mobility shift assay was performed using a DNA-protein binding detection kit (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol. .. Briefly, the NF-κB oligonucleotide probe (5’-AGT TGA GGG GAC TTT CCC AGG C-3’) was labeled with [g-32P] ATP by T4 polynucleotide kinase and purified on a Nick column (Amersham Pharmacia Biotech, Piscataway, NJ, USA).

    Article Title: Thymoquinone induces apoptosis of human renal carcinoma Caki-1 cells by inhibiting JAK2/STAT3 through pro-oxidant effect.
    Article Snippet: Currently, there are limited effective treatment options for renal cell carcinoma (RCC), due to its poor responses to conventional therapies.. Instead of using extrinsic anti-cancer drugs, cancer cell-intrinsic reactive oxygen species (ROS) can be a weapon of RCC treatment.. In the present study, we found that the phytochemical thymoquinone (TQ), a bioactive natural product obtained from the black cumin seeds of Nigella sativa, generates intracellular ROS in human renal cancer Caki-1 cells.

    Article Title: Wip1 directly dephosphorylates NLK and increases Wnt activity during germ cell development.
    Article Snippet: .. Electrophoretic mobility shift assay (EMSA) The EMSA for DNA binding of the different transcription factors was performed by using a DNA-protein binding detection kit according to the manufacturer’s protocol (ThermoFisher). .. Briefly, CD1TOP oligonucleotide harboring the binding sites for Cyclin D1 (5’- CTCTGCCGGCCTTTGATCTTTGCTTAACAACA-3’) was labeled with [γ32 P] AC C EP TE D M AN U SC R IP T ATP by using T4 polynucleotide kinase, and these oligonucleotides were purified on a Nick column (GE Healthcare, UK).

    Article Title: Titanium dioxide nanoparticles induce COX-2 expression through ROS generation in human periodontal ligament cells.
    Article Snippet: The supernatant containing nuclear proteins was collected and stored at -70°C after determination of protein concentration by using Bradford Reagent (Bio-Rad Laboratories, Hercules, CA, USA). .. Electrophoretic mobility gel shift assay (EMSA) The EMSA for NF-κB DNA binding was performed using a DNA-protein binding detection kit, according to the manufacturer’s protocol (GIBCO BRL, Grand Island, NY, USA). ..

    Article Title: Leptin induces SIRT1 expression through activation of NF-E2-related factor 2: Implications for obesity-associated colon carcinogenesis.
    Article Snippet: Leptin, a representative adipokine secreted from the white adipose tissue, is considered as a potential linker between obesity and cancer.. SIRT1 is a NAD-dependent histone/protein deacetylase speculated to function as an oncogene.. In the present study, we found that leptin signaling-defective ob/ob and db/db mice had lower colonic expression of SIRT1 compared with leptin signaling-intact C57BL/6J mice, implying that leptin signaling is crucial for SIRT1 expression in vivo.

    Article Title: Effects of Genetic and Pharmacologic Inhibition of COX-2 on Colitis-associated Carcinogenesis in Mice
    Article Snippet: .. Electrophoretic mobility shift assay was performed using a DNA-protein binding detection kit (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol. .. Briefly, the NF-κB oligonucleotide probe (5’-AGT TGA GGG GAC TTT CCC AGG C-3’) was labeled with [γ- 32 P] ATP by T4 polynucleotide kinase and purified on a Nick column (Amersham Pharmacia Biotech, Piscataway, NJ, USA).

    Article Title: p21 WAF1/Cip1 Regulation by hYSK1 Activates SP-1 Transcription Factor and Increases MMP-2 Expression under Hypoxic Conditions
    Article Snippet: Luciferase activity was determined after normalization to pRL-TK activity (Promega). .. EMSA for SP-1 DNA binding was performed using a DNA–protein binding detection kit, according to the manufacturer’s protocol (GIBCO BRL, Grand Island, NY, USA). .. Briefly, the SP-1 oligonucleotide probe 5′–GACCGAGTGCGCTCGGCGGCTGCGGAGAGGGGTAGAGCAGGCAGCGGGCGGCGGGGAGCAGC–3′ (SP-1 binding site in p16 INK4a promoter) [ ] was labeled with [γ- 32 P]ATP by T4 polynucleotide kinase and purified on a Nick column (Amersham Pharmacia Biotech, Buckinghamshire, UK).

    Gel Shift:

    Article Title: Titanium dioxide nanoparticles induce COX-2 expression through ROS generation in human periodontal ligament cells.
    Article Snippet: The supernatant containing nuclear proteins was collected and stored at -70°C after determination of protein concentration by using Bradford Reagent (Bio-Rad Laboratories, Hercules, CA, USA). .. Electrophoretic mobility gel shift assay (EMSA) The EMSA for NF-κB DNA binding was performed using a DNA-protein binding detection kit, according to the manufacturer’s protocol (GIBCO BRL, Grand Island, NY, USA). ..

    Article Title: Carnosol induces apoptotic cell death through ROS-dependent inactivation of STAT3 in human melanoma G361 cells
    Article Snippet: Immunoblot s were developed using enhanced chemiluminescence (ECL) reagent (GE Healthcare, NJ, USA) and visualized with ImagequantTM LAS 4000 (Fujifilm Life Science, Japan). .. Electrophoretic mobility gel shift assay (EMSA) The EMSA for STAT3 DNA binding was performed using a DNA–protein binding detection kit according to the manufacturer’s protocol (GIBCO BRL, Grand Island, NY). ..



    Similar Products

    90
    Thermo Fisher dna protein-binding detection kit
    Dna Protein Binding Detection Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+protein+binding+detection+kit/pmc10080013-67-16-18
    Average 90 stars, based on 1 article reviews
    dna protein-binding detection kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher dna protein binding detection kit
    Dna Protein Binding Detection Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dna+protein+binding+detection+kit/DNA/pm32165235-105-10-19
    Average 99 stars, based on 1 article reviews
    dna protein binding detection kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results